View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2479_high_69 (Length: 311)
Name: NF2479_high_69
Description: NF2479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2479_high_69 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 16 - 292
Target Start/End: Complemental strand, 41344069 - 41343793
Alignment:
| Q |
16 |
aatatcaatgggaatgagagctattcttggagagtcctccaacaaatggatacgaaaagtgaggatcattatgtaataagcaattcaaaggttgcagcta |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41344069 |
aatatcaatgggaatgagagctattcttggagagtcctccaacaaatggatacgaaaagtgaggatcattatgtaataagcaattcaaaggttgcagcta |
41343970 |
T |
 |
| Q |
116 |
cttgcatgttgatggaagaagcttttgggatgataacagacaaacatactggcgtcaatgtggtacaaagtgttttatacaaccgcaggtaagcacttct |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41343969 |
cttgcatgttgatggaagaagcttttgggatgataacagacaaacatactggcgtcaatgtggtacaaagtgttttatacaaccgcaggtaagcacttct |
41343870 |
T |
 |
| Q |
216 |
tagtcctaatacaaactctttttattagtagtattattcataatattcttctacttatatataatacaagcatgttc |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41343869 |
tagtcctaatacaaactctttttattagtagtattattcataatattcttctacttatatataatacaagcatgttc |
41343793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University