View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2479_high_80 (Length: 285)
Name: NF2479_high_80
Description: NF2479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2479_high_80 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 272
Target Start/End: Complemental strand, 42316672 - 42316405
Alignment:
| Q |
1 |
attgcaaatgtcacttttgataaacttattcannnnnnnnnnnnnnnattgaaattgtcgattcttggcaattgagaatgatgccaacaaaacaagagtc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42316672 |
attgcaaatgtcacttttgataaacttattcatttttaattttttttattgaaattgtcgattcttggcaattgagaatgatgccaacaaaacaagagtc |
42316573 |
T |
|
| Q |
101 |
gtgtccatcatgtaatgtaattgatgcgtggagtgggatgaaagatgtttgtttgtctctttgcattaaattggtctttgcttgttatggttttcttgta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42316572 |
gtgtccatcatgtaatgtaattgatgcgtggagtgggatgaaagatgtttgtttgtctctttgcattaaattggtctttgcttgttatggttttcttgta |
42316473 |
T |
|
| Q |
201 |
ggccatacatacacccatatatccgtatacctttcattttgagtttgacattcttggctattatatttacct |
272 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42316472 |
ggcca----tacacccatatatccgtatccctttcattttgagtttgacattcttggctattatatttacct |
42316405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University