View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2479_high_93 (Length: 270)
Name: NF2479_high_93
Description: NF2479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2479_high_93 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 1 - 257
Target Start/End: Original strand, 4287888 - 4288144
Alignment:
| Q |
1 |
ttggtaattgtgaataagtgggacctagttggagagttgccaaaaggaactagaccggtctttgtctcaatcagagggtgtgtcggctaccgtcaagtgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4287888 |
ttggtaattgtgaataagtgggacctagttggagagttgccaaaaggaactagaccggtctttgtctcaatcagagggggtgtcggctaccgtcaagtgg |
4287987 |
T |
 |
| Q |
101 |
attatgaaatcggacggtgaggattgtttgaaagtgaattaaaagcatcttcttaagataagacccacccactctctgtatgggaacgtgatacctggaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
4287988 |
gttatgaaatcggacggtgaggattgtttgaaagtgaattaaaagcatcttcttaagataagacccacccagtctctgtatgggaacgtgatacctggaa |
4288087 |
T |
 |
| Q |
201 |
tacagagagagaccccaaaaaggatggatttttctgtgttacgtgacactgcaccct |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4288088 |
tacagagagagaccccaaaaaggatggatttttctgtgttacgtgacactgcaccct |
4288144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University