View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2479_low_107 (Length: 252)
Name: NF2479_low_107
Description: NF2479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2479_low_107 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 6 - 242
Target Start/End: Original strand, 18018102 - 18018337
Alignment:
| Q |
6 |
aaaatgcaatactttaaactgtgttgtttgcctttacgattgaatttagtttgagagatatttgtgttaaaacaagatcaactttgagcatcttatattc |
105 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
18018102 |
aaaatgcaatactttaaactgtgttgcttgcctttacgattgaatttaatttgagagatatttgtgttaaaacaagatcaactttgagcatgttatattc |
18018201 |
T |
 |
| Q |
106 |
tcttgggcacaaatcaaaggggtattacccgggctccttgaggacctgggccatcgcactcccagcctattgcccaagaccggccctaaggggtagacaa |
205 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||| |||||||| |||||| || | |||||||||||||||||| |
|
|
| T |
18018202 |
tcttgggcacaaatcaaaggggtattacctaggccccttgaggacctgggccatcgcacttccagccta-tgcccaggatcagccctaaggggtagacaa |
18018300 |
T |
 |
| Q |
206 |
gacctcgtttgaaaagggaggaaaagtcaaagtataa |
242 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
18018301 |
gacctcgtttgaaaagagaggaaaagtcaaagtataa |
18018337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University