View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2479_low_127 (Length: 248)
Name: NF2479_low_127
Description: NF2479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2479_low_127 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 30885575 - 30885815
Alignment:
| Q |
1 |
tgatctctataatcttgacaggctaaaaatgttatgtgaatcaaaattgtgcgaagaaatcaatactgagaccgtagccacaacacttgccctggctgag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
30885575 |
tgatctctataatcttgacaggctaaaaatgttatgtgaatcaaaattgtgtgaagaaatcaatactgagaccgtagccacgacacttgccctggctgag |
30885674 |
T |
|
| Q |
101 |
caacaccattgtccacagctcaagacgatctgtttgaaatttattgcaaatccgacaaatttgggaggtgcgtgctattgcatgttattgtttgtacaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30885675 |
caacaccattgtccacagctcaagacgatctgtttgaaatttattgcaaatccgacaaatttgggaggtgcgtgctattgcatgttattgtttgtacaat |
30885774 |
T |
|
| Q |
201 |
gtttctgatgatactgcaggggtttgatttgatagtataat |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30885775 |
gtttctgatgatactgcaggggtttgatttgatagtataat |
30885815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University