View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2479_low_133 (Length: 244)
Name: NF2479_low_133
Description: NF2479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2479_low_133 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 105; Significance: 1e-52; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 2 - 122
Target Start/End: Original strand, 33726836 - 33726956
Alignment:
| Q |
2 |
ttttcttgttgtcaattttttcggttggagtttcataaattaaaacttaatattgaaaagaactttgtcctcctttatatattaatctacctcattggac |
101 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
33726836 |
ttttcctgttgtcaattttttcggttggagtttcataaatgaaaacttaatattgaaaagaactttgtcctcctttagatattaatcaacctcattggac |
33726935 |
T |
 |
| Q |
102 |
cgggccctaacaagttggtat |
122 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
33726936 |
cgggccctaacaagttggtat |
33726956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 176 - 228
Target Start/End: Original strand, 33727010 - 33727062
Alignment:
| Q |
176 |
ttattcaactatattccattttgtcaaattaattgttaaaatcaaataaccct |
228 |
Q |
| |
|
||||| || |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33727010 |
ttatttaattatattccattttgtcaaattaattgttaaaatcaaataaccct |
33727062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University