View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2479_low_152 (Length: 226)
Name: NF2479_low_152
Description: NF2479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2479_low_152 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 10 - 125
Target Start/End: Complemental strand, 42729346 - 42729231
Alignment:
| Q |
10 |
catcatcaattgtttaattatttagctatcaaatggtcacaacatcaaataaaatttatttggacgcatgcacaaaaatagtttagttacattatttaat |
109 |
Q |
| |
|
|||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42729346 |
catcatcaattgcttaattatttagctatcagatggtcacaacatcaaataaaatttatttggacgcatgcacaaaaatagtttagttacattatttaat |
42729247 |
T |
 |
| Q |
110 |
cttttcctcttttaac |
125 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
42729246 |
cttttcctcttttaac |
42729231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University