View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2479_low_160 (Length: 201)
Name: NF2479_low_160
Description: NF2479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2479_low_160 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 15 - 187
Target Start/End: Complemental strand, 4287439 - 4287267
Alignment:
| Q |
15 |
aatataaagtgtggggtttggttgggtgatgtattgtaaaatcatgcagcttgcagcctttgaattcaattgagttgaattgattgtgggggcaagtggt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4287439 |
aatataaagtgtggggtttggttgggtgatgtattgtaaaatcatgcagcttgcagcctttgaattcaattgagttgaattgattgtgggggcaagtggt |
4287340 |
T |
|
| Q |
115 |
gaaggaaggtgtttgtatttggaacatgtatgtgtctttggttaaaggtttggatgaaagtggtgttatgatt |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4287339 |
gaaggaaggtgtttgtatttggaacatgtatgtgtctttggttaaaggtttggatgaaagtggtgttatgatt |
4287267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University