View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2479_low_24 (Length: 427)
Name: NF2479_low_24
Description: NF2479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2479_low_24 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 396; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 396; E-Value: 0
Query Start/End: Original strand, 20 - 423
Target Start/End: Complemental strand, 45545046 - 45544643
Alignment:
| Q |
20 |
cttcctacactatttctctgccggaaaacatgtttgggtctttttcttcgccttattgggtattgctcctttggctgaacgtctaggttatgctaccgag |
119 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45545046 |
cttcctacactatttctctggcggaaaacatgtttgggtctttttcttcgccttattgggtattgctcctttggctgaacgtctaggttatgctaccgag |
45544947 |
T |
 |
| Q |
120 |
caacttgctttctacaccggaccaacacttgggggtttacttaatgcaacatttggaaatgcaactgaaatgattatatctatatacgctttgaaaagcg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45544946 |
caacttgctttctacaccggaccaacacttgggggtttacttaatgcaacatttggaaatgcaactgaaatgattatatctatatacgctttgaaaagcg |
45544847 |
T |
 |
| Q |
220 |
atatgattcgtgttgttcagcaatctttacttggttccatcttgtccaatatgcttcttgtccttggatgtgcattctttactggtggtattgttcacta |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45544846 |
atatgattcgtgttgttcagcaatctttacttggttccatcttgtccaatatgcttcttgtccttggatgtgcattctttactggtggtattgttcacta |
45544747 |
T |
 |
| Q |
320 |
caataaacttcaggttttcaataaggcagctgctgttgtcaactcaggcttgttgttgatggctgtaatgggaatactatttccagccgtgcttcatctc |
419 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
45544746 |
caataaacttcaggttttcaataaggcagctgctgttgtcaactcaggcttgttgttgatggctgtaatgggaatactatttccagccgtgcttcatttc |
45544647 |
T |
 |
| Q |
420 |
actc |
423 |
Q |
| |
|
|||| |
|
|
| T |
45544646 |
actc |
45544643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University