View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2479_low_43 (Length: 364)
Name: NF2479_low_43
Description: NF2479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2479_low_43 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 58 - 350
Target Start/End: Complemental strand, 17577423 - 17577130
Alignment:
| Q |
58 |
aggtagatgaaagtagtgaattcctaccattggtgtatgatccagctagtattactgcatattggggaaaacgtcctcgctccgttgcaactcgcattgt |
157 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17577423 |
aggtagatgaaagtagtgaatttctaccattggtgtatgatccagctagtattactgcatattggggaaaacgtcctcgctccgttgcaactcgcattgt |
17577324 |
T |
 |
| Q |
158 |
gcagttattatctgttgctggaggttttctttcgcgggttgcgtgggatgtggttaacaagaaggttaaagaggtaatttttctatgtccagat-agact |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
17577323 |
gcagttattatctgttgctggaggttttctttcgcgggttgcgtgggatgtggttaacaagaaggttaaagaggtaatttttctatgtccagataagact |
17577224 |
T |
 |
| Q |
257 |
aagcagcttgcgtgcattcttgacatggtggtcattgtcggtggnnnnnnnattctcccttgctttctgtttcttctcttgtcgataactaata |
350 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||||||| |||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
17577223 |
aagcagcttgcgtgcattcctgacatggtggttattgtcggtggtttttttattctcccttgctttctgtttcttttcttgtcgataactaata |
17577130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University