View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2479_low_60 (Length: 329)
Name: NF2479_low_60
Description: NF2479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2479_low_60 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 157; Significance: 2e-83; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 16 - 188
Target Start/End: Original strand, 33726146 - 33726317
Alignment:
| Q |
16 |
ctattgctgttttggcaaatacaatcccactcactcaactagtgtgtcagaaagtgcttaatcatgggtaaagattatgcttctagaacatcttttttat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33726146 |
ctattgctgttttggcaaatacaatcccactcactcaaatagtgtgtcagaaagtgcttaatcatgggtaaagattatgcttctagaacatcttttttat |
33726245 |
T |
|
| Q |
116 |
ttatagatttatctctttggcttttcaatatttaaaagataaataacctgattgaatataaaaagatcattta |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
33726246 |
ttatagatttatctctttggcttttcaatatttaaaagataaataacctgattgtatat-aaaagatcattta |
33726317 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 263 - 329
Target Start/End: Original strand, 33726731 - 33726798
Alignment:
| Q |
263 |
atttggaaatttt-tattaataaaataattatgagactatcatattttttgaattaagatttaacaat |
329 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33726731 |
atttggaaattttttattaataaaataattatgagactatcatattttttgaattaagatttaacaat |
33726798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 203 - 244
Target Start/End: Original strand, 33726691 - 33726732
Alignment:
| Q |
203 |
taattgctaaattagtttcttttgatgaggtgtgttaaacat |
244 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
33726691 |
taattgctaaattactttcttttgatgaggtgtgttaaacat |
33726732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University