View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2479_low_66 (Length: 322)

Name: NF2479_low_66
Description: NF2479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2479_low_66
NF2479_low_66
[»] chr1 (2 HSPs)
chr1 (119-309)||(17577928-17578118)
chr1 (22-92)||(17578144-17578214)


Alignment Details
Target: chr1 (Bit Score: 191; Significance: 1e-104; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 119 - 309
Target Start/End: Complemental strand, 17578118 - 17577928
Alignment:
119 cttctgcttctgatttcgccgaattcactgatttcaacgtgtgtttttatttgcattcagagaattggtgatgtttcgaaggagattaagagagtgagag 218  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
17578118 cttctgcttctgatttcgccgaattcactgatttcaacgtgtgtttttatttgcattcagagaattggtgatgtttcgaaggagattaagagagtgagag 17578019  T
219 cgcaaatggaagaagatgaacaattggcaacgcttatgagaggtcttcgtggtcagagtcttaatgattcgctctttgctgaggatgatgt 309  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
17578018 cgcaaatggaagaagatgaacaattggcaacgcttatgagaggtcttcgtggtcagagtcttaatgattcgctctttgctgaggatgatgt 17577928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 22 - 92
Target Start/End: Complemental strand, 17578214 - 17578144
Alignment:
22 gtcactaccgtcaacggttcttcttcaaggtctccgcctgccaaacctgtcaacggtgtctctggggtaaa 92  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
17578214 gtcactaccgtcaacggttcttcttcaaggtctccgcctgccaaacctgtcaacggtgtctctggggtaaa 17578144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University