View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2479_low_71 (Length: 315)
Name: NF2479_low_71
Description: NF2479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2479_low_71 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 164; Significance: 1e-87; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 46 - 305
Target Start/End: Complemental strand, 44551744 - 44551486
Alignment:
| Q |
46 |
caaaaagaaagttcacttcattcaacagagggttttttatattattagannnnnnnnaatgaagttgaaatggtccnnnnnnnatctaagaaaggatatt |
145 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| |||||| ||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
44551744 |
caaaaagaaagttcactacattcaacagagggttttttatat-attagattttttt-aatgaagttgaaatggtcctttttt-atctaagaaaggatatt |
44551648 |
T |
|
| Q |
146 |
tataacatttacttattttgataacgggtatgaatat--gtatgcatgtatgccattaaatatgtatttgtattaattaagtaacagacaattgaatttg |
243 |
Q |
| |
|
|||| |||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
44551647 |
tataccatttacttattttgataacgggtataaatatatgtatgcatgtatgccattaaatatgtatttgtattaattaagtaacagacaattcaatttg |
44551548 |
T |
|
| Q |
244 |
tctatttattttactcgtagataactaaaatgtctaaagttcgaatttagacccttgtattt |
305 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
44551547 |
tctatttattttactcgtagataactgaaatgtctaaagttcgaacttagacccttgtattt |
44551486 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University