View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2479_low_75 (Length: 307)
Name: NF2479_low_75
Description: NF2479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2479_low_75 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 154; Significance: 1e-81; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 150 - 307
Target Start/End: Original strand, 27734917 - 27735074
Alignment:
| Q |
150 |
ttacgaggtttttgtaaagtggagatttttatgaggtgaattgaagtattatcaagatctgacatttacattggagaatgaaattctagggttgtgtatg |
249 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27734917 |
ttacgaggtttttgtaaagtgtagatttttatgaggtgaattgaagtattatcaagatctgacatttacattggagaatgaaattctagggttgtgtatg |
27735016 |
T |
 |
| Q |
250 |
aagaataagaaaaatggggtatgcaaaaaatgtcgaaagaacaagaatttgaaaatga |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27735017 |
aagaataagaaaaatggggtatgcaaaaaatgtcgaaagaacaagaatttgaaaatga |
27735074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University