View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2479_low_77 (Length: 297)
Name: NF2479_low_77
Description: NF2479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2479_low_77 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 39 - 204
Target Start/End: Original strand, 16594458 - 16594619
Alignment:
| Q |
39 |
taattcttgaatgctgttgcaaagtcaatctcaaatctcaaacaatt-gctaatattaaaaataaaaatgctaatttcatgttcaatcacttttaatgag |
137 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
16594458 |
taattcttgaatgctgttgcaaaggcaatctcaaatctcaaacaatttgctaatattaaa------aatgctaatttcatgttcaatcacttttaatgag |
16594551 |
T |
 |
| Q |
138 |
aatcaaattatataaatgcaattcgtgcttacttaatggtcagcaaccac-tacaagaaaatatatga |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
16594552 |
aatcaaattatataaatgcaattcgtgcttacttaatggtcagcaaccacatacaagaaaatatatga |
16594619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 13 - 56
Target Start/End: Original strand, 16593476 - 16593519
Alignment:
| Q |
13 |
atgaagataaagaacacaactgggtctaattcttgaatgctgtt |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16593476 |
atgaagataaagaacacaactgggtctaattcttgaatgctgtt |
16593519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University