View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2479_low_78 (Length: 295)
Name: NF2479_low_78
Description: NF2479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2479_low_78 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 16 - 271
Target Start/End: Original strand, 4676795 - 4677050
Alignment:
| Q |
16 |
aaaataatagtgttcatgtgagggtacctcagttagtacccgtctatttactagtatctatagcaaggatataagactttaattaaaaaactagttaagt |
115 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4676795 |
aaaataatagtgttcatgtgagggtaactcagttagtacccgtctatccactagtatctatagcaaggatataagactttaattaaaaaactagttaagt |
4676894 |
T |
 |
| Q |
116 |
ttcatgataataagaacaatatcttaatagaaaaagaggaacggcaagggagcttgcaacaaactatttatctttttcgattctcatattctcttttctt |
215 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
4676895 |
ttcatgataataagaacaatatcttaataaaaaaagaggaacggcaagggagcttgcaacaaactatttatctttttcgattctcatgttctcttttctt |
4676994 |
T |
 |
| Q |
216 |
tgcactttcctttacccttcccttgttttcattatttcttgttgtgacctatttat |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
4676995 |
tgcactttcctttacccttcccttgttttcattatttcttggtgtgacctatttat |
4677050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University