View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2479_low_84 (Length: 285)
Name: NF2479_low_84
Description: NF2479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2479_low_84 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 165; Significance: 3e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 18 - 230
Target Start/End: Original strand, 10125267 - 10125479
Alignment:
| Q |
18 |
atattatggatagtgtcgtaaaaatagtaaggaatttttacaataattttggacgcaacacatttgagaatgtcatagnnnnnnnnagggggagaatgtc |
117 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
10125267 |
atattatgggtagtgtcgtaaaaatagtaaggaatttttacaataattttggacacaacaaatttgagaatgtcatagttttttttagggggagaatgtc |
10125366 |
T |
|
| Q |
118 |
atagttaaaatacaatttgtatagaatatctaataatttgagaatgtcgtagttaaacctttttgtgtccgaaaattccaaaatttacaccaaaatgact |
217 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
10125367 |
atacttaaaatacaatttgtatagaatatctaataatttgagaatgtcgtagttagaccttttggtgtccgaaaattccaaaatttacaccaaaatgact |
10125466 |
T |
|
| Q |
218 |
agaatatctaata |
230 |
Q |
| |
|
||||||||||||| |
|
|
| T |
10125467 |
agaatatctaata |
10125479 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University