View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2479_low_89 (Length: 276)
Name: NF2479_low_89
Description: NF2479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2479_low_89 |
 |  |
|
| [»] chr7 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 125; Significance: 2e-64; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 1 - 276
Target Start/End: Original strand, 41614364 - 41614629
Alignment:
| Q |
1 |
attactaaaatatgataaaatattgagtattc--taaccnnnnnnntttaaaaggatagaaatggttttacctttaaccaacattgtaacnnnnnnnnnn |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
41614364 |
attactaaaatatgataaaatattgagtatgaagtaaccaaaaaaatttaaaaggatagaaatggttttacctttaaccaacattgcaacaaaaaatata |
41614463 |
T |
 |
| Q |
99 |
nnnnnnnnnntgatcatagcataaacatttgctcttggtggaatcatgtttgttcctgtgtttgttgttagtagcttttagcagtatcttatattgtaat |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
41614464 |
aaaagaaaaatgatcatagcataaacatttgctcttggtggaatcatgtttgttcctgtgtttgttgttagtaacttttagcagtatcttatattg---- |
41614559 |
T |
 |
| Q |
199 |
tggtcatataattggtctcctgactttttattatattggctgttattttggctttagcataggtgattttgcaaattt |
276 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41614560 |
--------taattggtctcctaactttttattatattggctgttattttggctttagcataggtgattttgcaaattt |
41614629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 225 - 273
Target Start/End: Original strand, 41621675 - 41621724
Alignment:
| Q |
225 |
tttattatattggctgttattttgg-ctttagcataggtgattttgcaaa |
273 |
Q |
| |
|
||||||| ||||||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
41621675 |
tttattacattggctgttattttggcctttagaataggtgattttgcaaa |
41621724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 187
Target Start/End: Original strand, 41621570 - 41621620
Alignment:
| Q |
137 |
tggaatcatgtttgttcctgtgtttgttgttagtagcttttagcagtatct |
187 |
Q |
| |
|
|||| |||||||||||||| ||||| |||| ||||||| |||||||||||| |
|
|
| T |
41621570 |
tggagtcatgtttgttcctctgtttcttgtgagtagctcttagcagtatct |
41621620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University