View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2479_low_92 (Length: 271)
Name: NF2479_low_92
Description: NF2479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2479_low_92 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 1 - 254
Target Start/End: Complemental strand, 18018104 - 18017851
Alignment:
| Q |
1 |
ttttataaccaacaaattgttgaacttccaatagattcttgaggatttgtgtttaaaattacatgcaaattttagtcatcaactttgtttaaagtgttgt |
100 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
18018104 |
ttttataatcaacaaattgttgaacttccaatagattcttgaggatttgtgtttaaaattacatgcaaattttagtcatcaacattgtttaaagtgttgt |
18018005 |
T |
|
| Q |
101 |
tctatttagccatcgacacaactctctcggcatcttcttcgaacaacttgaattaaattggatgttgatactgctgtgccatatcaaatcaactacgaag |
200 |
Q |
| |
|
||||||| ||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
18018004 |
tctatttggccatcggcacaactctctcgacatcttcttcgaacaacttgaattaaattggatgttgatactgccgtgccatatcaaatcaactacgaag |
18017905 |
T |
|
| Q |
201 |
atctgcacaacgaacaaacggtgagatagtatgacgatttttgcgtagtataca |
254 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
18017904 |
atctgcacaacgaacaaacagtgagatagtatgacgatttttgcgtagtataca |
18017851 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University