View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2479_low_95 (Length: 271)
Name: NF2479_low_95
Description: NF2479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2479_low_95 |
 | |
|
| [»] scaffold0002 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0002 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 1 - 253
Target Start/End: Original strand, 338152 - 338404
Alignment:
| Q |
1 |
acttagttgaatttcactgttaatttactagtgttcgagaaaaataaaacacgtgatttgcttccagctcttgacgtactgatgtggataaataatataa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
338152 |
acttagttgaatttcactgttaatttactagtgttcgagaaaaataaaacacgtgatttgcttccagctcttgacgtactgatgtggataaataatataa |
338251 |
T |
|
| Q |
101 |
tgctttctctattctatggcactgaccttctactttttcttgtcattttggttaaannnnnnnnaggttgctccagatgttaaagaagtcctagatacgt |
200 |
Q |
| |
|
| |||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
338252 |
tactttctctattctatgtcactgaccttctactttttcttgtcattttggttaaattctttttaggttgctccagatgttaaagaagtcctagatacgt |
338351 |
T |
|
| Q |
201 |
ttcgagtttctgcagagatagggagtgatgcacttggagcatatgtgatctct |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
338352 |
ttcgagtttctgcagagatagggagtgatgcacttggagcatatgtgatctct |
338404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University