View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2480_low_6 (Length: 329)
Name: NF2480_low_6
Description: NF2480
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2480_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 89 - 311
Target Start/End: Original strand, 12008638 - 12008860
Alignment:
| Q |
89 |
caatatgaagaatagcaatttaatgttcaaagattgattagcaaatatagagaattatggtggaataagtttaattttggttgaaattatgcaatagtaa |
188 |
Q |
| |
|
||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12008638 |
caatatgcagaatagcaatttaattttcaaagattgattagcaaatatagagaattatggtggaataagtttaattttggttgaaattatgcaatagtaa |
12008737 |
T |
|
| Q |
189 |
aatgttaggtcgaagtttatgatctgtcgcatttcatattgtaaaatcaagttttcaaagatgagatgtgctttaataatctatgatttctttcggagat |
288 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12008738 |
aatgttaggtcaaagtttaggatctgtcgcatttcatattgtaaaatcaagttttcaaagatgagatgtgctttaataatctatgatttctttcggagat |
12008837 |
T |
|
| Q |
289 |
acataaaaatgccttgaatcaac |
311 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
12008838 |
acataaaaatgccttgaatcaac |
12008860 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 27 - 69
Target Start/End: Original strand, 11984810 - 11984852
Alignment:
| Q |
27 |
agaatatttttaccaaatcacacttatcatatcattattcaaa |
69 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
11984810 |
agaatatttttaccaattcacacttatcatatcattaatcaaa |
11984852 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University