View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2481_low_10 (Length: 261)
Name: NF2481_low_10
Description: NF2481
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2481_low_10 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 19 - 261
Target Start/End: Original strand, 21093106 - 21093353
Alignment:
| Q |
19 |
gaagaagaaggcatcaattgtcgaacatgtcctatccaaaggtcattcaacgccgttaactcaaggatctcaggtccgactggataaaaactttagtgnn |
118 |
Q |
| |
|
||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21093106 |
gaagaagaaggcatcaactgtcgaacgtgtcctatccaaaggtcattcaacgccgttaactcaaggatctcaggtccgactggataaaaactttagtttt |
21093205 |
T |
 |
| Q |
119 |
nnnnn-----aacgaggatcaagaactttattaacaataaaaattatcaaagcaagactaaaattgaattagatgatgagtttcttcgaaataacgtgat |
213 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
21093206 |
ttttttttttaaagaggatcaagaactttattaacaataaaaattatcaaaggaagactaaaattgagttagatgatgagtttcttcgaaataacgtgat |
21093305 |
T |
 |
| Q |
214 |
tatttacattgaaaaatactttgttagtcaatttgatataattagatt |
261 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
21093306 |
tatttacattgaaaaagactttgttagtcaatttgatataagtagatt |
21093353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University