View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2481_low_13 (Length: 239)
Name: NF2481_low_13
Description: NF2481
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2481_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 4 - 225
Target Start/End: Original strand, 21093436 - 21093653
Alignment:
| Q |
4 |
catcagaaaatattttatttctcacggcctttggcttttgcttcttgatgacgaatatgatatcagagaagtgacaagagaagactacaagactgtaatt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21093436 |
catcagaaaatattttatttctcacggcctttggcttttgcttcttgatgacgaatatgatatcagagaagtgacaagagaagactacaagactgtaatt |
21093535 |
T |
 |
| Q |
104 |
gcatttgcgaatcttcactgttttgtctttatgcaggatagataggaactaaagtggaacttgcttacgaatgcaggttttgccattttgagttttctat |
203 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21093536 |
gcatttgagaatcttcactgttttgtctttatgcag----gataggaactaaagtggaacttgcttacgaatgcaggttttgccattttgagttttctat |
21093631 |
T |
 |
| Q |
204 |
aacaatttgcatagactttttt |
225 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
21093632 |
aacaatttgcatagactttttt |
21093653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University