View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2481_low_14 (Length: 233)
Name: NF2481_low_14
Description: NF2481
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2481_low_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 8 - 218
Target Start/End: Original strand, 49291826 - 49292036
Alignment:
| Q |
8 |
tagcataggacaataaaatttgtgaaaccataaaacttatatactgcctaatcattattctataacacaactctgaaattttgtctacatgcgaatatta |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
49291826 |
tagcataggacaataaaatttgtgaaaccataaaacttatctactgcctaatcattattctataacacaactctgaaattttgtctacaggcgaagatta |
49291925 |
T |
 |
| Q |
108 |
tgtatgttttttcccattttatattttaacatatccatgtatataaaatttccaactgtatcatgaaatcatttcagtttaacgcttttacaggaatagt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||| |||||||||||||||| || |||||||| |
|
|
| T |
49291926 |
tgtatgttttttcccattttatattttaacatatccatgtatataaaatttccaaatgcatcatgaaatcctttcagtttaacgcttgtatcggaatagt |
49292025 |
T |
 |
| Q |
208 |
tcttttagttt |
218 |
Q |
| |
|
||||||||||| |
|
|
| T |
49292026 |
tcttttagttt |
49292036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University