View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2482_low_10 (Length: 227)
Name: NF2482_low_10
Description: NF2482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2482_low_10 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 7 - 227
Target Start/End: Original strand, 27977315 - 27977535
Alignment:
| Q |
7 |
tcttagtcttgtgaaaggaatgaaaaatgaggttgagaagacacttgatgaacttgatcaagctattgggattagtagtgttcatagagagacaaaaaag |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
27977315 |
tcttagtcttgtgaaaggaatgaaaaatgatgttgagaagacacttgatgaacttgatcaagctattgggattagcagtgctcatagagagacaaaaaag |
27977414 |
T |
|
| Q |
107 |
aacacaaaaggtaatagaatacctttgaggtctatcttgtttggtgtcaagttaaagagacaaaagcagtatcaatcactgttttcatgtgtcaatccta |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27977415 |
aacacaaaaggtaatagaatacctttgaggtctttcttgtttggtgtcaagttaaagagacaaaagcagtatcaatcactgttttcatgtgtcaatccta |
27977514 |
T |
|
| Q |
207 |
cactgtctaaacaaaatagta |
227 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
27977515 |
cactgtctaaacaaaatagta |
27977535 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University