View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2482_low_11 (Length: 213)
Name: NF2482_low_11
Description: NF2482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2482_low_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 82; Significance: 7e-39; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 1 - 115
Target Start/End: Original strand, 8184518 - 8184632
Alignment:
| Q |
1 |
tgccaaatctcttcttcatatcaggtaagactaagatttaccagctctctacacatcaatagattgacctttnnnnnnncaacgataaattacaatcgct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| | |
|
|
| T |
8184518 |
tgccaaatctcttcttcatatcaggtaagactaagatttaccagctctctacacatcaatagattgacctttaaaaaaacaacgataaattacaatcgtt |
8184617 |
T |
|
| Q |
101 |
ataattcaagctcgt |
115 |
Q |
| |
|
|||| ||||||||| |
|
|
| T |
8184618 |
ataaaccaagctcgt |
8184632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 164 - 213
Target Start/End: Original strand, 8184681 - 8184730
Alignment:
| Q |
164 |
gaaagaaaggagaaaagataaactaaactaagattaaattgtttcttaat |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8184681 |
gaaagaaaggagaaaagataaactaaactaagattaaattgtttcttaat |
8184730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University