View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2483_high_13 (Length: 275)
Name: NF2483_high_13
Description: NF2483
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2483_high_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 167; Significance: 2e-89; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 86 - 260
Target Start/End: Original strand, 39330610 - 39330784
Alignment:
| Q |
86 |
gttcttctgggtgctaaatcaactatgctgcaggtgctatatcgatatcgccatcatcgtcgtctccttcactcttcctctgagtgcaacagttgttgaa |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39330610 |
gttcttctgggtgctaaatcaactatgctgcaggtgctatatcaatatcaccatcatcgtcgtctccttcactcttcctctgagtgcaacagttgttgaa |
39330709 |
T |
 |
| Q |
186 |
ttgagttgcagccaagtcacttcccatgtttctcatgagaagatttgattccatggaacttaggaccaccattgt |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39330710 |
ttgagttgcagccaagtcacttcccatgtttctcatgagaagatttgattccatggaacttaggaccaccattgt |
39330784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 7 - 85
Target Start/End: Complemental strand, 39330600 - 39330522
Alignment:
| Q |
7 |
gagagatgaagagttatagctattagctagcagcacctgagttgtgctgcatttgtagaataagaaatgggggtattta |
85 |
Q |
| |
|
|||| |||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39330600 |
gagaaatgaagagttatagatattggctagcagcacctgagttgtgctgcatttgtagaataagaaatgggggtattta |
39330522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University