View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2485_high_37 (Length: 236)
Name: NF2485_high_37
Description: NF2485
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2485_high_37 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 41448829 - 41448599
Alignment:
| Q |
1 |
aaatggccagctggttgagcagtatgcagaagcagtttcacactacatagtgtgtataagttcttaactccaacatcaaaataaatatctggacataatt |
100 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
41448829 |
aaatggccggctggttgagcaatatgcagaagcagtttcacactacatagtgtgtataagttcttaactccaacatcaaaacaaatatctggacataata |
41448730 |
T |
 |
| Q |
101 |
gaaccaaagataaatttggcatctttcagtaagaa-gttataaagaaaataagccaa---------ttcgataaaacgtgaactagccctaccaattcag |
190 |
Q |
| |
|
||||||||||||| ||||| ||| ||||||||||| |||||||||||||||||||| || ||||||||||||||||| ||||||| ||||| |
|
|
| T |
41448729 |
gaaccaaagataattttgggatcgttcagtaagaatattataaagaaaataagccaatgtactccgttggataaaacgtgaactagacctaccatttcag |
41448630 |
T |
 |
| Q |
191 |
tagcaatgaacaaagttcaattggaaaaatt |
221 |
Q |
| |
|
|||||||||||| ||||| |||||||||||| |
|
|
| T |
41448629 |
tagcaatgaacagagttctattggaaaaatt |
41448599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University