View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2485_low_25 (Length: 368)
Name: NF2485_low_25
Description: NF2485
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2485_low_25 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 18 - 340
Target Start/End: Complemental strand, 4982180 - 4981864
Alignment:
| Q |
18 |
cttctgacctaacttcgaagccgcacgtggttcggaagaaggttttaaattcgacgacgacgatgataattcttttgtcgtcgtagtcgttgtcgttggt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||| ||||||| || |
|
|
| T |
4982180 |
cttctgacctaacttcgaagccgcacgtggttcggaagaaggttttaaattcgacgacgatgatgataattcttttgtggtcgtcgtcgttg------gt |
4982087 |
T |
|
| Q |
118 |
gattcgaataaagtacagagcttcttcaccattcttccacgtagagatgatttcattgactccattgaaccgtagaatttgcttaacgaaccggaccggt |
217 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4982086 |
gattcgaataaagtgcagatcttcttcaccattcttccacgtagagatgatttcattgactccattgaaccgtagaatttgcttaacgaaccggaccggt |
4981987 |
T |
|
| Q |
218 |
ctagaaattcgttgaatggtttctgtgattgttcttttgatgacgtgtgcatcgtgttcgatcggttgaagaattgaaacctcgacatctttgaaaattc |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4981986 |
ctagaaattcgttgaatggtttctgtgattgttcttttgatgacgtgtgcatcgtgttcgatcggttgaagaattgaaacctcgacatctttgaaaattc |
4981887 |
T |
|
| Q |
318 |
ttcgaaaaattcgataattcaac |
340 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
4981886 |
ttcgaaaaattcgataattcaac |
4981864 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University