View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2485_low_28 (Length: 353)
Name: NF2485_low_28
Description: NF2485
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2485_low_28 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 139 - 338
Target Start/End: Complemental strand, 37734045 - 37733846
Alignment:
| Q |
139 |
agttttcttccgcccgcgcatctatcacacaacgaaagcgcgttaccgagcctagcaccggaggctttccacggtgtcggagattgacaagcgtgacaga |
238 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
37734045 |
agttttcttccgccggcgcatctatcacacaacgaaagcgcgttaccgagcctagcaccggaggctttccacggcgtgggagattgacaagcgtgacaga |
37733946 |
T |
|
| Q |
239 |
ggagagttctcatgtgtctctcaaccaaaaagttagcagcgtggaccttagaatcgcagtcccagcataagctagcctggtctgactcacagaaagttct |
338 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37733945 |
ggagagttctcatgtgtctctcaaccaaaaagttagcagcgtggaccttagaatcgcagtcccagcataagctagcctggtctgactcacagaaagttct |
37733846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 19 - 89
Target Start/End: Complemental strand, 37734147 - 37734077
Alignment:
| Q |
19 |
gaatcgtaatccgtatcttcttcattgtcattgtcaccttcgctttcttcttgttgttcagcgctggtacc |
89 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37734147 |
gaatcgtaatccgtatcttcttcattgtcattgtcaccttcgctttcatcttgttgttcagcgctggtacc |
37734077 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University