View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2486_high_12 (Length: 225)
Name: NF2486_high_12
Description: NF2486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2486_high_12 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 169; Significance: 9e-91; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 17 - 217
Target Start/End: Complemental strand, 9558858 - 9558657
Alignment:
| Q |
17 |
acaatcatgttccgaaacctgcaatcnnnnnnnccctaacaaaaatgacaagaatgttgtataagaaacacaattaaggagattgaatgtgtgagaaaa- |
115 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9558858 |
acaatcatgttccgaaacctgcaatcaaaaaaaccctaacaaaaattacaagaatgttgtataagaaacacaattaaggagattgaatgtgtgagaaaaa |
9558759 |
T |
|
| Q |
116 |
ttaccaattttttgagattttgagcggtgtcgttgtgaaccagagcattgtctagggttttgggacgatacttgtctacccacaacatctttcttctctc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9558758 |
ttaccaattttttgagattttgagcggtgtcgttgtgaaccagagcattgtctagggttttgggacgatacttgtctacccacaacatctttcttctctc |
9558659 |
T |
|
| Q |
216 |
tc |
217 |
Q |
| |
|
|| |
|
|
| T |
9558658 |
tc |
9558657 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 116 - 213
Target Start/End: Original strand, 25410824 - 25410921
Alignment:
| Q |
116 |
ttaccaattttttgagattttgagcggtgtcgttgtgaaccagagcattgtctagggttttgggacgatacttgtctacccacaacatctttcttctc |
213 |
Q |
| |
|
|||||||||| ||||||||||||||| ||||| ||||||||| ||||| ||| || ||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
25410824 |
ttaccaatttcttgagattttgagcgatgtcgctgtgaaccatagcatggtcaagagttttgggacggtacttgtcaacccacaacatctttcttctc |
25410921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 88 - 213
Target Start/End: Complemental strand, 19185002 - 19184876
Alignment:
| Q |
88 |
aattaaggagattgaatgtgtgagaaaa-ttaccaattttttgagattttgagcggtgtcgttgtgaaccagagcattgtctagggttttgggacgatac |
186 |
Q |
| |
|
|||||| ||||||||||||||||||||| |||||||||||| |||||| || | | ||| ||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
19185002 |
aattaatgagattgaatgtgtgagaaaaattaccaatttttcgagattaagaacaatatcgctgtgaaccaaaacattgtctagggttttgggacgatac |
19184903 |
T |
|
| Q |
187 |
ttgtctacccacaacatctttcttctc |
213 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
19184902 |
ttgtctacccacaacatctttcttctc |
19184876 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University