View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2488R-Insertion-7 (Length: 174)
Name: NF2488R-Insertion-7
Description: NF2488R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2488R-Insertion-7 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 141; Significance: 3e-74; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 141; E-Value: 3e-74
Query Start/End: Original strand, 10 - 174
Target Start/End: Original strand, 33989787 - 33989950
Alignment:
| Q |
10 |
ttcttttcttgcataccaaacaacgtgttaccgtgtcgataacttaagggaaagaaaagcgaagattactacacacgtaatgtttcggaaaagattcaag |
109 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
33989787 |
ttcttttcttgcagaccaaacaacgtgttaccgtgtcgataatttaagggaaagaaaatcgaagattactacacacgtaatgtttcgg-aaagattcaag |
33989885 |
T |
 |
| Q |
110 |
aagaaaacagtgtccattcttttctactatataaatacatgcatgttatatacgttagtttcaat |
174 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33989886 |
aagaaaacagtgttcattcttttctactatataaatacatgcatgttatatacgttagtttcaat |
33989950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University