View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2488_low_2 (Length: 379)
Name: NF2488_low_2
Description: NF2488
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2488_low_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 179; Significance: 2e-96; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 179; E-Value: 2e-96
Query Start/End: Original strand, 24 - 230
Target Start/End: Original strand, 8777962 - 8778171
Alignment:
| Q |
24 |
gtataacaacaccgcttttacctcacttatatctactgatcaacctatttgctacctgctagtactcgaccctacttagacgtcaaagtcctttgcaagc |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8777962 |
gtataacaacaccgcttttacctcacttatatctactgatcaacctatttgctacctgctagtactcgaccctacttagacgtcaaagtcctttgcaagc |
8778061 |
T |
 |
| Q |
124 |
acactccccttcgttggagaaggggtgtatgaccactcctatatgattcaatcatcga--atggaag-acaccccttgctcataatgtacacccacaatt |
220 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||| |||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
8778062 |
acactccccttcgttggagaaggggtctacgaccagtcctatatgattcaatcatcgaggatggaagcacaccccttgctcataatgtacacccacaatt |
8778161 |
T |
 |
| Q |
221 |
attcatacat |
230 |
Q |
| |
|
|||||||||| |
|
|
| T |
8778162 |
attcatacat |
8778171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 322 - 361
Target Start/End: Original strand, 8778268 - 8778307
Alignment:
| Q |
322 |
cattcaaacatctgtaatgagcatacaaaaatctaaaatc |
361 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8778268 |
cattcaaacatctgtaatgagcatacaaaaatctaaaatc |
8778307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University