View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2488_low_5 (Length: 327)

Name: NF2488_low_5
Description: NF2488
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2488_low_5
NF2488_low_5
[»] chr3 (1 HSPs)
chr3 (140-312)||(40889422-40889598)
[»] scaffold0221 (1 HSPs)
scaffold0221 (38-80)||(25160-25202)
[»] chr7 (1 HSPs)
chr7 (103-139)||(11593117-11593153)


Alignment Details
Target: chr3 (Bit Score: 156; Significance: 7e-83; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 156; E-Value: 7e-83
Query Start/End: Original strand, 140 - 312
Target Start/End: Complemental strand, 40889598 - 40889422
Alignment:
140 agtggtaaactagtcttacctattctactaacgcaacacctgagaccaatagcatagttatatgatttacttttatttgaaaagtagaaaggggttagta 239  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40889598 agtggtaaactagtcttacctattctactaacgcaacacctgataccaatagcatagttatatgatttacttttatttgaaaagtagaaaggggttagta 40889499  T
240 aggttcttttgtgtgcagaatcaagttaatttctcaaaaataaattaagaaggt----tttaagaaaagaaataatt 312  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||    |||||||||||||||||||    
40889498 aggttcttttgtgtgcagaatcaagttaatttctcaaaaataaattaagaaggtttaatttaagaaaagaaataatt 40889422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0221 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: scaffold0221
Description:

Target: scaffold0221; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 38 - 80
Target Start/End: Complemental strand, 25202 - 25160
Alignment:
38 tcgacgtggttctctcaagcgccctagtatactctacttgttc 80  Q
    ||||| |||||||||||||||||||||||||||||||||||||    
25202 tcgacatggttctctcaagcgccctagtatactctacttgttc 25160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 103 - 139
Target Start/End: Complemental strand, 11593153 - 11593117
Alignment:
103 gtcagttcaccgggaggatcgccctcccaattcgaag 139  Q
    |||||||||  ||||||||||||||||||||||||||    
11593153 gtcagttcattgggaggatcgccctcccaattcgaag 11593117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University