View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2489_low_8 (Length: 236)

Name: NF2489_low_8
Description: NF2489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2489_low_8
NF2489_low_8
[»] chr8 (2 HSPs)
chr8 (1-93)||(10556879-10556971)
chr8 (152-221)||(10556752-10556821)


Alignment Details
Target: chr8 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 1 - 93
Target Start/End: Complemental strand, 10556971 - 10556879
Alignment:
1 ttgagtgaaaatggaatgagttgagactaggacttggtagacatttatatagaacaaatgggggatactacaatacaatattatgttgataac 93  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10556971 ttgagtgaaaatggaatgagttgagactaggacttggtagacatttatatagaacaaatgggggatactacaatacaatattatgttgataac 10556879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 152 - 221
Target Start/End: Complemental strand, 10556821 - 10556752
Alignment:
152 gtaactaatcaattaaccgaccaattgtgttatttgaatatcaaaatacgaacacatttagtgaaattat 221  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||    
10556821 gtaactaatcaattaaccgaccaattgtgttatttgaatatcaaaatacgaacatatttagtgacattat 10556752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University