View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2489_low_8 (Length: 236)
Name: NF2489_low_8
Description: NF2489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2489_low_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 1 - 93
Target Start/End: Complemental strand, 10556971 - 10556879
Alignment:
| Q |
1 |
ttgagtgaaaatggaatgagttgagactaggacttggtagacatttatatagaacaaatgggggatactacaatacaatattatgttgataac |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10556971 |
ttgagtgaaaatggaatgagttgagactaggacttggtagacatttatatagaacaaatgggggatactacaatacaatattatgttgataac |
10556879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 152 - 221
Target Start/End: Complemental strand, 10556821 - 10556752
Alignment:
| Q |
152 |
gtaactaatcaattaaccgaccaattgtgttatttgaatatcaaaatacgaacacatttagtgaaattat |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
10556821 |
gtaactaatcaattaaccgaccaattgtgttatttgaatatcaaaatacgaacatatttagtgacattat |
10556752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University