View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2491_low_13 (Length: 241)
Name: NF2491_low_13
Description: NF2491
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2491_low_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 24 - 226
Target Start/End: Complemental strand, 54600043 - 54599829
Alignment:
| Q |
24 |
ttatgcagttgatagatagtttatgtaaggtttccacaattgacagtttaacaaatggatagaggagaacccaattcgttattgaatcagaaataaaatt |
123 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54600043 |
ttatgcggttgatagatagtttatgtaaggtttccacaattgacagtttaacaaatggatagaggagaacccaattcgttattgaatcagaaataaaatt |
54599944 |
T |
 |
| Q |
124 |
gataaaggagaattcaattagaat------------tgcataaaagagaaatagagaagaataagtctagagaattaagtgattattctactagagagta |
211 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54599943 |
gataaaggagaattcaattagaattggtgttcccggtgcataaaagagaaatagagaagaataagtctagagaattaagtgattattctactagagagta |
54599844 |
T |
 |
| Q |
212 |
tcaaaaagagaaaag |
226 |
Q |
| |
|
|||||| |||||||| |
|
|
| T |
54599843 |
tcaaaaggagaaaag |
54599829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University