View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2491_low_14 (Length: 239)
Name: NF2491_low_14
Description: NF2491
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2491_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 136; Significance: 4e-71; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 1 - 136
Target Start/End: Original strand, 37054628 - 37054763
Alignment:
| Q |
1 |
ctagtctttgtcaaagtacaagcatgttgttcaacatcttcacctaatgcatcaagatagaacagatctagtcctggatttaaactcaccttgccttttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37054628 |
ctagtctttgtcaaagtacaagcatgttgttcaacatcttcacctaatgcatcaagatagaacagatctagtcctggatttaaactcaccttgccttttg |
37054727 |
T |
 |
| Q |
101 |
tttttcctttggtattgctgctgcaaagaggcattg |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
37054728 |
tttttcctttggtattgctgctgcaaagaggcattg |
37054763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 178 - 222
Target Start/End: Original strand, 37054805 - 37054849
Alignment:
| Q |
178 |
ctgcagaataagattaagccaagagaaataacaaatgcagcaact |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37054805 |
ctgcagaataagattaagccaagagaaataacaaatgcagcaact |
37054849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University