View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2491_low_15 (Length: 238)
Name: NF2491_low_15
Description: NF2491
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2491_low_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 40535103 - 40534880
Alignment:
| Q |
1 |
ttgtgtgtcgacatttaactgtctgcttcgtagatgctatgctatgtgtctgcttgtatgaatctggatattgtttctagaaaatgttggtacaatactt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
40535103 |
ttgtgtgtcgacatttaactgtctgcttcgtagatgctatgctatgtgtctgcttgtatgaatctggatattgtttctagaaaatgttgttacaatactt |
40535004 |
T |
 |
| Q |
101 |
ggccaaaacatcattctcttgccaacgatttgaaacacaccgatagtttttcactc--tctcaaagacacatgtcctacacttggcattcagttcgtgac |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40535003 |
ggccaaaacatcattctcttgccaacgatttgaaacacaccgatagtttttcactctctctcaaagacacatgtcctacacttggcattcagttcgtgac |
40534904 |
T |
 |
| Q |
199 |
acatagcctatctcctttatttct |
222 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
40534903 |
acatagcctatctcctttatttct |
40534880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University