View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2492_high_15 (Length: 239)
Name: NF2492_high_15
Description: NF2492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2492_high_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 9 - 221
Target Start/End: Original strand, 38728624 - 38728836
Alignment:
| Q |
9 |
gcaattagaggtttaggaggtgatagagatctgatttcgggtgcagaattggggaaaagtatgttcagcttgtgcatcaggatatcagccctagatggaa |
108 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38728624 |
gcaattagaggtttaggaggggatagagatctgatttcgggtgcagaattggggaaaagtatgttcagcttgtgcatcaggatatcagccctagatggaa |
38728723 |
T |
 |
| Q |
109 |
tttcattcagaagaaactgttgaactatcggtttcttaaaccactccatgacagaatctcctggtgctctaagaacaactttactcacctcaaatggaga |
208 |
Q |
| |
|
||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||| || || |||||||| |||||||| |||||||| ||||| |
|
|
| T |
38728724 |
tttcattcagaagaaactgctgaactattggtttcttaaaccactccatgacagaatctcccggcgccctaagaaccactttacttacctcaaacggaga |
38728823 |
T |
 |
| Q |
209 |
ctctaccgagctt |
221 |
Q |
| |
|
|||||| |||||| |
|
|
| T |
38728824 |
ctctactgagctt |
38728836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 45 - 219
Target Start/End: Complemental strand, 386882 - 386708
Alignment:
| Q |
45 |
tcgggtgcagaattggggaaaagtatgttcagcttgtgcatcaggatatcagccctagatggaatttcattcagaagaaactgttgaactatcggtttct |
144 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
386882 |
tcgggtgcagaattgggaaaaagtatgttcagcttgtgcatcaggatatcagccctagatggaatttcattcagaagaaactgctgaactatcggtttct |
386783 |
T |
 |
| Q |
145 |
taaaccactccatgacagaatctcctggtgctctaagaacaactttactcacctcaaatggagactctaccgagc |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
386782 |
taaaccactccatgacagaatctcctggtgctctaagaacaactttactcacctcaaatggagactctaccgagc |
386708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University