View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2492_high_7 (Length: 344)
Name: NF2492_high_7
Description: NF2492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2492_high_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 318; Significance: 1e-179; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 318; E-Value: 1e-179
Query Start/End: Original strand, 17 - 334
Target Start/End: Complemental strand, 10461326 - 10461009
Alignment:
| Q |
17 |
aattatgaatcaaataatttgatgttacaatcattttatggccagactcattgatgaataggaaagcagaatccaataatcaaaatttcaaactatagaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10461326 |
aattatgaatcaaataatttgatgttacaatcattttatggccagactcattgatgaataggaaagcagaatccaataatcaaaatttcaaactatagaa |
10461227 |
T |
 |
| Q |
117 |
gcttacgtgtaaatttgatatttggaatttcaaacataatagatggtgttttgcttgtcgtcctaatttcctatgctatcttttggttttcggttaggcc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10461226 |
gcttacgtgtaaatttgatatttggaatttcaaacataatagatggtgttttgcttgtcgtcctaatttcctatgctatcttttggttttcggttaggcc |
10461127 |
T |
 |
| Q |
217 |
ttttaatttgttccccttctttagtagtattaggcatctgtgtgtctgctattcatgtataaaattgaacttttaaaattaaaaggtataaaattgaaaa |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10461126 |
ttttaatttgttccccttctttagtagtattaggcatctgtgtgtctgctattcatgtataaaattgaacttttaaaattaaaaggtataaaattgaaaa |
10461027 |
T |
 |
| Q |
317 |
gctaatcttgtccctatg |
334 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
10461026 |
gctaatcttgtccctatg |
10461009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University