View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2492_low_10 (Length: 346)
Name: NF2492_low_10
Description: NF2492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2492_low_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 299; Significance: 1e-168; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 28 - 342
Target Start/End: Original strand, 35689374 - 35689688
Alignment:
| Q |
28 |
atgaagtttcaaaacattgaacttaacagggtggttcaggagttggattcggaaattttatagagtttggccctcttgatgccaatttggagccaaggaa |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35689374 |
atgaagtttcaaaacattgaacttaacagggtggttcaggagttggattcggaaattttatagagtttggccctcttgatgccaatttggagccaaggaa |
35689473 |
T |
|
| Q |
128 |
tttcacttggttgagaaaagcagatttgctatttgtggtaacacaaattattttcttctgaattgtggtaactcaattttgcgtatgtttagaaaaacag |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
35689474 |
tttcacttggttgagaaaagcagatttgctatttgtggtaactcaaattattttcttctgaattgtggtaacccaattttgcgtatgtttagaaaaacag |
35689573 |
T |
|
| Q |
228 |
tgaattttataaaatttgacaaaaattacagtgataccgtaattacggttgctcactgtaaattttcctaaattcaccgtcaattcaaacatgcatcaac |
327 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35689574 |
tgaattttataaaatttgacaaaaattacagtgataccgtaattacggttgctcgctgtaaattttcctaaattcaccgtcaattcaaacatgcatcaac |
35689673 |
T |
|
| Q |
328 |
taattcatctcactc |
342 |
Q |
| |
|
|||||||| |||||| |
|
|
| T |
35689674 |
taattcatgtcactc |
35689688 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University