View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2492_low_13 (Length: 313)
Name: NF2492_low_13
Description: NF2492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2492_low_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 163 - 297
Target Start/End: Original strand, 20184880 - 20185014
Alignment:
| Q |
163 |
aacatagccactctcacacaattacccctaaaacgttatgttttttcaagacatatnnnnnnnttatgaacatgaaagtaaagagaacaatcaaaatcaa |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20184880 |
aacatagccactctcacacaattacccctaaaaagttatgttttttcaagacatataaaaaaattatgaacatgaaagtaaagagaacaatcaaaatcaa |
20184979 |
T |
|
| Q |
263 |
tgataatgtagaggtggggaataacagggactttt |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
20184980 |
tgataatgtagaggtggggaataacagggactttt |
20185014 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 1 - 115
Target Start/End: Original strand, 20184714 - 20184831
Alignment:
| Q |
1 |
tgaggagataaattccttaattctatcatgctcaaggtaagatatcgtgcgtcaaaaatact---gtgtataatgaagacatttttataattgtcatgca |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
20184714 |
tgaggagataaattccttaattctatcatgctcaagataagatatcgtgcgtcagaaatactactgtgtataatgaagacatttttataattgtcatgca |
20184813 |
T |
|
| Q |
98 |
aatattactactaagttg |
115 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
20184814 |
aatattactactaagttg |
20184831 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University