View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2492_low_27 (Length: 217)
Name: NF2492_low_27
Description: NF2492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2492_low_27 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 2933673 - 2933888
Alignment:
| Q |
1 |
catactactaaaaacacatattttcaacaacatgaaaccaccgtcaccttttttatagtgaaacacaannnnnnnnnnnaagacaaattattttatcaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
2933673 |
catactactaaaaacacatattttcaacaacatgaaaccaccgtcaccttttttatagtgaaacacaatttttttttt-aagacaaattattttctcaat |
2933771 |
T |
 |
| Q |
101 |
gactctcttcaaaacgaaccggaactgcataaatttggtaaggtataccataaattagctgcttctgtaagtaatatatcgtttttgtataatttaaagt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
2933772 |
gactctcttcaaaacgaaccggaactgcataaatttggtaaggtataccataaattagctgcttctgtaagtaatatatcgttttggtataatttaaagt |
2933871 |
T |
 |
| Q |
201 |
aataacttaggtagcca |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
2933872 |
aataacttaggtagcca |
2933888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University