View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2493_low_11 (Length: 250)
Name: NF2493_low_11
Description: NF2493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2493_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 203 - 235
Target Start/End: Complemental strand, 10780462 - 10780430
Alignment:
| Q |
203 |
tgtgttgatattaactaatactttctttttaat |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
10780462 |
tgtgttgatattaactaatactttctttttaat |
10780430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 128 - 181
Target Start/End: Original strand, 25435716 - 25435769
Alignment:
| Q |
128 |
gacacattttccaacacataatttttatttttggtaccttaacatgtgccctaa |
181 |
Q |
| |
|
|||||| ||| |||| |||||||| ||| |||| |||||||||||||||||||| |
|
|
| T |
25435716 |
gacacaattttcaacgcataatttctatctttgataccttaacatgtgccctaa |
25435769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University