View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2493_low_5 (Length: 320)
Name: NF2493_low_5
Description: NF2493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2493_low_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 141; Significance: 6e-74; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 160 - 312
Target Start/End: Original strand, 48020371 - 48020523
Alignment:
| Q |
160 |
tgggtattacatgaaaagcaaattacaacaaaatgggtgacttacgccatgaaggtgagctcctaacacagcaatcaacagtaagttgttctttgacagg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48020371 |
tgggtattacatgaaaagcaaattacaacaaaatgggttacttacgccatgaaggtgagctcctaacacagcaatcaacagtaagttgttctttgacagg |
48020470 |
T |
|
| Q |
260 |
atgaggttgaaaatgatcaactttaccactttcaccagctgcctttgcttctc |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
48020471 |
atgaggttgaaaatgatcaactttaccactttcaccagctgccattgtttctc |
48020523 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 17 - 99
Target Start/End: Original strand, 48020227 - 48020309
Alignment:
| Q |
17 |
aggaacaagaatagtggaaacaatgacaatggttccaagcattacaaggtagtgctgaaacccaagaaaaatcccttcagctg |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
48020227 |
aggaacaagaatagtggaaacaatgacaatggttccaagcattacaaggtagtgttgaaacccaagaaaaatcccttcagctg |
48020309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University