View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2493_low_9 (Length: 253)
Name: NF2493_low_9
Description: NF2493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2493_low_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 25 - 206
Target Start/End: Original strand, 511902 - 512083
Alignment:
| Q |
25 |
ctaaaatctgatattaggattagtcgatagtatgtaattatgcatcaacatgtctgtaacggttcatgtcatcaatgtttcacatgtatatcacgataaa |
124 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
511902 |
ctaaaatctgatattagcattagtcgatagtatgtaattatgcatcaacatgtctgtaacggttcatgtcatcaatgtttcacatgtatatcacgataaa |
512001 |
T |
|
| Q |
125 |
catgtttatccattactattgatctatgaacatgtttatctaatttggcagggatttctaaattatctcacacaatattcat |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
512002 |
catgtttatccattactattgatctatgaacatgtttatctaatttggcagggatttctaaattatctcacacaatattcat |
512083 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University