View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2495_high_100 (Length: 239)
Name: NF2495_high_100
Description: NF2495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2495_high_100 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 7 - 239
Target Start/End: Original strand, 38709547 - 38709779
Alignment:
| Q |
7 |
ggacatcatctctttttattataccatgaactaatacttctaaaagatatcgattgcacccatgaactaatacttcgaaaggtatttaattgatccatgt |
106 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38709547 |
ggacatcatttctttttattataccatgaactaatacttctaaaagatatcgattgcacccatgaactaatacttcgaaaggtatttaattgatccatgt |
38709646 |
T |
 |
| Q |
107 |
gtacttctaaagcatataaatgaccaataaacctaatgccttaagattttgattgaatgtagtatctgcaatggtgggtggtctgggaacctctattttc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
38709647 |
gtacttctaaagcatataaatgaccaataaacctaatgccttaagattttgattgaatgtggtatctgcaatggtaggtggtctgggaacctctattttc |
38709746 |
T |
 |
| Q |
207 |
ctggcaaaattctttatgagatcaactaaatcc |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
38709747 |
ctggcaaaattctttatgagatcaactaaatcc |
38709779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University