View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2495_high_103 (Length: 238)
Name: NF2495_high_103
Description: NF2495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2495_high_103 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 17 - 238
Target Start/End: Complemental strand, 33779654 - 33779433
Alignment:
| Q |
17 |
atgtggcaccattgaaagggttagtccttctgtatttgtagcttttgtatgtttcaaaaaagtgttgcagtattgcatgctagaagtaatgaaaattctt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33779654 |
atgtggcaccattgaaagggttagtccttctgtatttgtagcttttgtaggttacaaaaaagtgttgcagtattgcatgctagaagtaatgaaaattctt |
33779555 |
T |
 |
| Q |
117 |
cattcatattcatccgaaccttttgacttgtgagctcatttcttttaaaaattcaagatacggcattgttccttcaagaacannnnnnnctcgatttgtt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
33779554 |
cattcatattcatccgaaccttttgacttgtgcgctcatttcttttaaaaattcaagatacggcattgttccttcaagaacatttttttctcgatttgtt |
33779455 |
T |
 |
| Q |
217 |
tatgttattgtcatagcttggc |
238 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
33779454 |
tatgttattgtcatagcttggc |
33779433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University