View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2495_high_110 (Length: 237)
Name: NF2495_high_110
Description: NF2495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2495_high_110 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 17 - 237
Target Start/End: Complemental strand, 25118385 - 25118165
Alignment:
| Q |
17 |
aacagcttgttcaacattggttttcacttgagtactattaaaccctgcttctctcataaccctacttacactaggatcatctaaaattgaaataatgagt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
25118385 |
aacagcttgttcaacattggttttcacttgagtactattaaaccctgcttctctcataaccctactaacactaggatcatctaaaattgaaatgatgagt |
25118286 |
T |
 |
| Q |
117 |
tgttcaagctcaatcttcaccgtcaaaagcggttgttgttgattctcaatcgatccacgacgttgatgagcttgagcgcgcttaaaagcggcaactaaag |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25118285 |
tgttcaagctcaatcttcaccgtcaaaagcggttgttgttgattctcaatcgatccacgacgttgatgagcttgagcgcgcttaaaagcggcaactaaag |
25118186 |
T |
 |
| Q |
217 |
catttgagatagaaggatact |
237 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
25118185 |
catttgagatagaaggatact |
25118165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000005; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 63 - 223
Target Start/End: Complemental strand, 53818250 - 53818090
Alignment:
| Q |
63 |
gcttctctcataaccctacttacactaggatcatctaaaattgaaataatgagttgttcaagctcaatcttcaccgtcaaaagcggttgttgttgattct |
162 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||| | |||||| || ||||||||||| | |||| || || | | ||||||||||||||| | | |
|
|
| T |
53818250 |
gcttctctcatgaccctactaacactaggatcatcaagaattgatatgatgagttgttccaattcaactttgacagcaagaagcggttgttgttgctgtt |
53818151 |
T |
 |
| Q |
163 |
caatcgatccacgacgttgatgagcttgagcgcgcttaaaagcggcaactaaagcatttga |
223 |
Q |
| |
|
|| | ||||||||||||||||||||||| || || ||||| || | ||||||||||| |
|
|
| T |
53818150 |
caggataaccacgacgttgatgagcttgagcacgtttcaaagctgccatcaaagcatttga |
53818090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 63 - 129
Target Start/End: Original strand, 52806676 - 52806742
Alignment:
| Q |
63 |
gcttctctcataaccctacttacactaggatcatctaaaattgaaataatgagttgttcaagctcaa |
129 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| | || || ||||| || ||||||||||||| |
|
|
| T |
52806676 |
gcttctctcataaccctactaacactaggatcatcaagtatagatataataagctgttcaagctcaa |
52806742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University