View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2495_high_112 (Length: 236)
Name: NF2495_high_112
Description: NF2495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2495_high_112 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 16 - 236
Target Start/End: Complemental strand, 13975863 - 13975643
Alignment:
| Q |
16 |
ctatcctcttccctagattttattattaatcattgttactactcgccattgcatttttcttgtgttctagcattgaggatagtttttccatattccctaa |
115 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
13975863 |
ctatcctcttccctagattatattattaatcattgttactactcgccattgcatttttcttgtgttttagcattgaggatagtttttccatactccctaa |
13975764 |
T |
|
| Q |
116 |
ttgatttccgatggttagtatggttagcatggaggatagtattccccactcttcccaggaaaatgttgttagataattctgaatggagctttggaatttt |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
13975763 |
ttgatttccgatggttagtatggttagcatggaggatagtattccccactcttccaaggaaaatgttgttatataattctgaatggagcttttgaatttt |
13975664 |
T |
|
| Q |
216 |
aaccctaacaacaactattct |
236 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
13975663 |
aaccctaacaacaactattct |
13975643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University